shRNA Adeno-associated Virus Serotype 2, pH1-(CCDC11-shRNA-Seq1)(CAT#: AAV-SI0983WQ)

This product is a CCDC11-shRNA encoding AAV, which is based on AAV-2 serotype. The CCDC11 gene belongs to the CFAP53 family. It was found to be differentially expressed by the ciliated cells of frog epidermis and in skin fibroblasts from human. The expression of CCDC11-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CCDC11-shRNA-Seq1
Related Target/Protein CCDC11
Region CDS
TargetSeq CGGAAAGCACAGATTGCATTT
NCBI RefSeq NM_145020
Alternative Names HTX6; CFAP53
Titer >1*10^10 GC/mL
Related Diseases Visceral heterotaxy-6
Target Gene
Gene ID 220136
Uniprot ID Q96M91

Related Products

Advertisement