shRNA Adeno-associated Virus Serotype 2, pH1-(CEP170L-shRNA-Seq1)(CAT#: AAV-SI0924WQ)
This product is a CEP170L-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of CEP170L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | CEP170L-shRNA-Seq1 |
Related Target/Protein | CEP170L |
Region | CDS |
TargetSeq | GCTCTGAACAACATGGGATTT |
NCBI RefSeq | NM_153243 |
Alternative Names | FAM68B; CEP170L; KIAA0470L |
Titer | >1*10^10 GC/mL |