shRNA Adeno-associated Virus Serotype 2, pH1-(CLMP-shRNA-Seq3)(CAT#: AAV-SI0600WQ)
This product is a CLMP-shRNA encoding AAV, which is based on AAV-2 serotype. The CLMP gene encodes a type I transmembrane protein that is localized to junctional complexes between endothelial and epithelial cells and may have a role in cell-cell adhesion. The expression of CLMP-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | CLMP-shRNA-Seq3 |
| Related Target/Protein | CLMP |
| Region | CDS |
| TargetSeq | CCTTGCAGATTGAACCTCTGA |
| NCBI RefSeq | NM_024769 |
| Alternative Names | ACAM; ASAM; CSBM; CSBS |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Congenital short bowel syndrome |
