shRNA Adeno-associated Virus Serotype 2, pH1-(COQ9-shRNA-Seq2)(CAT#: AAV-SI0621WQ)
This product is a COQ9-shRNA encoding AAV, which is based on AAV-2 serotype. The COQ9 gene encoded protein is likely necessary for biosynthesis of coenzyme Q10, as mutations at this locus have been associated with autosomal-recessive neonatal-onset primary coenzyme Q10 deficiency. The expression of COQ9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | COQ9-shRNA-Seq2 |
| Related Target/Protein | COQ9 |
| Region | CDS |
| TargetSeq | CTATGAAAGTGAGGAGCAGTT |
| NCBI RefSeq | NM_020312 |
| Alternative Names | COQ10D5; C16orf49; HSPC326; PSEC0129 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Autosomal-recessive neonatal-onset primary coenzyme Q10 deficiency |
