shRNA Adeno-associated Virus Serotype 2, pH1-(CTTNBP2NL-shRNA-Seq1)(CAT#: AAV-SI0794WQ)

This product is a CTTNBP2NL-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of CTTNBP2NL-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CTTNBP2NL-shRNA-Seq1
Related Target/Protein CTTNBP2NL
Region CDS
TargetSeq CTTTGGCACAGACTATCGAAA
NCBI RefSeq NM_018704
Alternative Names KIAA1433
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55917
Uniprot ID Q9P2B4

Related Products

Inquiry Now
Advertisement