shRNA Adeno-associated Virus Serotype 2, pH1-(DOLK-shRNA-Seq1)(CAT#: AAV-SI0967WQ)
This product is a DOLK-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by DOLK gene catalyzes the CTP-mediated phosphorylation of dolichol, and is involved in the synthesis of Dol-P-Man. The expression of DOLK-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | DOLK-shRNA-Seq1 |
Related Target/Protein | DOLK |
Region | CDS |
TargetSeq | GCCTTTGCTTGGACTAGTCAT |
NCBI RefSeq | NM_014908 |
Alternative Names | DK; DK1; CDG1M; SEC59; TMEM15 |
Titer | >1*10^10 GC/mL |
Related Diseases | Dolichol kinase deficiency |