shRNA Adeno-associated Virus Serotype 2, pH1-(Fchsd1-shRNA-Seq1)(CAT#: AAV-SI2733WQ)

This product is a Fchsd1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Fchsd1 gene may promotes actin polymerization mediated by SNX9 and WASL. The expression of Fchsd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Fchsd1-shRNA-Seq1
Related Target/Protein Fchsd1
Region CDS
TargetSeq GAAGGCAACGTCTCAGGTAAA
NCBI RefSeq NM_175684
Alternative Names NWK2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 89848
Uniprot ID Q86WN1

Related Products

Inquiry Now
Advertisement