shRNA Adeno-associated Virus Serotype 2, pH1-(Gm16776-shRNA-Seq2)(CAT#: AAV-SI2934WQ)

This product is a Gm16776-shRNA encoding AAV, which is based on AAV-2 serotype. The Gm16776 gene can regulate the immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell. The expression of Gm16776-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Gm16776-shRNA-Seq2
Related Target/Protein Gm16776
Region CDS
TargetSeq CCAGTGAATTTGATCTGTTCT
NCBI RefSeq XM_355759
Alternative Names Trbv16; Tcrb-V11
Titer >1*10^10 GC/mL
Target Gene
Gene ID 100124680
Uniprot ID A0A0B4J1H3

Related Products