shRNA Adeno-associated Virus Serotype 2, pH1-(Gsdmd-shRNA-Seq1)(CAT#: AAV-SI3166WQ)
This product is a Gsdmd-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Gsdmd gene is a member of the gasdermin family and play a role in regulation of epithelial proliferation. The expression of Gsdmd-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Gsdmd-shRNA-Seq1 |
| Related Target/Protein | Gsdmd |
| Region | CDS |
| TargetSeq | CTGGTGAACATCGGAAAGATT |
| NCBI RefSeq | NM_026960 |
| Alternative Names | DF5L; DFNA5L; FKSG10; GSDMDC1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |
