shRNA Adeno-associated Virus Serotype 2, pH1-(Gsdmd-shRNA-Seq1)(CAT#: AAV-SI3166WQ)

This product is a Gsdmd-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Gsdmd gene is a member of the gasdermin family and play a role in regulation of epithelial proliferation. The expression of Gsdmd-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Gsdmd-shRNA-Seq1
Related Target/Protein Gsdmd
Region CDS
TargetSeq CTGGTGAACATCGGAAAGATT
NCBI RefSeq NM_026960
Alternative Names DF5L; DFNA5L; FKSG10; GSDMDC1
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 79792
Uniprot ID P57764

Related Products

Advertisement