shRNA Adeno-associated Virus Serotype 2, pH1-(HEATR2-shRNA-Seq2)(CAT#: AAV-SI0887WQ)
This product is a HEATR2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by HEATR2 gene is essential for the preassembly or stability of axonemal dynein arms, and is found only in organisms with motile cilia and flagella. The expression of HEATR2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | HEATR2-shRNA-Seq2 |
Related Target/Protein | HEATR2 |
Region | 3UTR |
TargetSeq | GCCAAAGTGATTAGAAAGAAA |
NCBI RefSeq | NM_017802 |
Alternative Names | CILD18; DNAAF5 |
Titer | >1*10^10 GC/mL |
Related Diseases | Primary ciliary dyskinesia-18 |