shRNA Adeno-associated Virus Serotype 2, pH1-(Hexim1-shRNA-Seq1)(CAT#: AAV-SI3130WQ)
This product is a Hexim1-shRNA encoding AAV, which is based on AAV-2 serotype. Expression of Hexim1 gene is induced by hexamethylene-bis-acetamide in vascular smooth muscle cells. The expression of Hexim1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Hexim1-shRNA-Seq1 |
Related Target/Protein | Hexim1 |
Region | 3UTR |
TargetSeq | GCCAAGATAAACTTGTGAGAA |
NCBI RefSeq | NM_138753 |
Alternative Names | CLP1; EDG1; HIS1; MAQ1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Viral infection |