shRNA Adeno-associated Virus Serotype 2, pH1-(Lactb2-shRNA-Seq7)(CAT#: AAV-SI2789WQ)
This product is a Lactb2-shRNA encoding AAV, which is based on AAV-2 serotype. The Lactb2 gene is required for normal mitochondrial function and cell viability. The expression of Lactb2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Lactb2-shRNA-Seq7 |
Related Target/Protein | Lactb2 |
Region | 3UTR |
TargetSeq | GCTGGCTTACAGTTCAGAGAT |
NCBI RefSeq | NM_145381 |
Alternative Names | CGI-83 |
Titer | >1*10^10 GC/mL |