shRNA Adeno-associated Virus Serotype 2, pH1-(LGI4-shRNA-Seq1)(CAT#: AAV-SI0592WQ)
This product is a LGI4-shRNA encoding AAV, which is based on AAV-2 serotype. The LGI4 gene encoded protein is component of Schwann cell signaling pathway(s) that controls axon segregation and myelin formation (By similarity). The expression of LGI4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | LGI4-shRNA-Seq1 |
Related Target/Protein | LGI4 |
Region | CDS |
TargetSeq | CAACTCCTTCTCCGTGATTGA |
NCBI RefSeq | NM_139284 |
Alternative Names | LGIL3; AMCNMY |
Titer | >1*10^10 GC/mL |
Related Diseases | Neurological diseases |