shRNA Adeno-associated Virus Serotype 2, pH1-(Lipk-shRNA-Seq1)(CAT#: AAV-SI3078WQ)
This product is a Lipk-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Lipk gene plays a highly specific role in the last step of keratinocyte differentiation and may have an essential function in lipid metabolism of the most differentiated epidermal layers. The expression of Lipk-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Lipk-shRNA-Seq1 |
Related Target/Protein | Lipk |
Region | CDS |
TargetSeq | CCTTATCTACTACAAGGAGAT |
NCBI RefSeq | NM_172837 |
Alternative Names | LIPL2; bA186O14.2 |
Titer | >1*10^10 GC/mL |