shRNA Adeno-associated Virus Serotype 2, pH1-(LOC154872-shRNA-Seq2)(CAT#: AAV-SI0765WQ)

This product is a LOC154872-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of LOC154872-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert LOC154872-shRNA-Seq2
Related Target/Protein LOC154872
Region CDS
TargetSeq GCAATATTGGAATCAAAGGAT
NCBI RefSeq NM_001024603
Alternative Names C7orf77
Titer >1*10^10 GC/mL
Target Gene
Gene ID 154872
Uniprot ID A4D0Y5

Related Products

Inquiry Now
Advertisement