shRNA Adeno-associated Virus Serotype 2, pH1-(LOC392563-shRNA-Seq3)(CAT#: AAV-SI2416WQ)
This product is a LOC392563-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by LOC392563 gene is a component of the mature neuronal cytoskeleton, and it interacts with the zygosome, which is mediated by neurofilament-related proteins. The expression of LOC392563-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | LOC392563-shRNA-Seq3 |
Related Target/Protein | LOC392563 |
Region | CDS |
TargetSeq | CCGGATAATTACGATCCGATA |
NCBI RefSeq | XM_373382 |
Titer | >1*10^10 GC/mL |
Related Diseases | Neurodegenerative diseases |