shRNA Adeno-associated Virus Serotype 2, pH1-(LSM12-shRNA-Seq2)(CAT#: AAV-SI0975WQ)
This product is a LSM12-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of LSM12-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | LSM12-shRNA-Seq2 |
| Related Target/Protein | LSM12 |
| Region | 3UTR |
| TargetSeq | GCTCCTCATTGAGGGATAGTT |
| NCBI RefSeq | NM_152344 |
| Alternative Names | PNAS-135 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Oxidative Stress |
