shRNA Adeno-associated Virus Serotype 2, pH1-(MAGEB2-shRNA-Seq1)(CAT#: AAV-SI0629WQ)

This product is a MAGEB2-shRNA encoding AAV, which is based on AAV-2 serotype. MAGEB2 gene is a member of the MAGEB gene family. The promoters and first exons of the MAGEB genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The expression of MAGEB2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert MAGEB2-shRNA-Seq1
Related Target/Protein MAGEB2
Region CDS
TargetSeq CCTGGGTGTGATCTTCTTAAA
NCBI RefSeq NM_002364
Alternative Names DAM6; CT3.2; MAGE-XP-2
Titer >1*10^10 GC/mL
Related Diseases Testis cancer
Target Gene
Gene ID 4113
Uniprot ID O15479

Related Products

Advertisement