shRNA Adeno-associated Virus Serotype 2, pH1-(Med18-shRNA-Seq5)(CAT#: AAV-SI2732WQ)

This product is a Med18-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Med18 gene is a component of the Mediator complex, which is a coactivator for DNA-binding factors that activate transcription via RNA polymerase II. The expression of Med18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Med18-shRNA-Seq5
Related Target/Protein Med18
Region 3UTR
TargetSeq GAATTAAAGGCGTGCGATAAC
NCBI RefSeq NM_026039
Alternative Names SRB5; p28b
Titer >1*10^10 GC/mL
Target Gene
Gene ID 54797
Uniprot ID Q9BUE0

Related Products

Inquiry Now
Advertisement