shRNA Adeno-associated Virus Serotype 2, pH1-(MRPL16-shRNA-Seq2)(CAT#: AAV-SI0717WQ)

This product is a MRPL16-shRNA encoding AAV, which is based on AAV-2 serotype. Among different species, the MRPL16 encoded proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. The expression of MRPL16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert MRPL16-shRNA-Seq2
Related Target/Protein MRPL16
Region 3UTR
TargetSeq GAAGTCTTTGGGTAGCTCTTA
NCBI RefSeq NM_017840
Alternative Names L16mt; MRP-L16; PNAS-111
Titer >1*10^10 GC/mL
Related Diseases Colorectal cancers
Target Gene
Gene ID 54948
Uniprot ID Q9NX20

Related Products

Inquiry Now
Advertisement