shRNA Adeno-associated Virus Serotype 2, pH1-(Ola1-shRNA-Seq3)(CAT#: AAV-SI2587WQ)

This product is a Ola1-shRNA encoding AAV, which is based on AAV-2 serotype. The Ola1 gene encodes a member of the GTPase protein family and interacts with breast cancer-associated gene 1 (BRCA1) and BRCA1-associated RING domain protein (BARD1), and is involved in centrosome regulation. The expression of Ola1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Ola1-shRNA-Seq3
Related Target/Protein Ola1
Region CDS
TargetSeq CTACCTTCTTCAATGTATTAA
NCBI RefSeq NM_025942
Alternative Names DOC45; GBP45; GTBP9; GTPBP9; PTD004
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 29789
Uniprot ID Q9NTK5

Related Products