shRNA Adeno-associated Virus Serotype 2, pH1-(Ola1-shRNA-Seq4)(CAT#: AAV-SI2588WQ)
This product is a Ola1-shRNA encoding AAV, which is based on AAV-2 serotype. The Ola1 gene encodes a member of the GTPase protein family and interacts with breast cancer-associated gene 1 (BRCA1) and BRCA1-associated RING domain protein (BARD1), and is involved in centrosome regulation. The expression of Ola1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Ola1-shRNA-Seq4 |
Related Target/Protein | Ola1 |
Region | 3UTR |
TargetSeq | CATGGGAATTAGAAGAAGAAT |
NCBI RefSeq | NM_025942 |
Alternative Names | DOC45; GBP45; GTBP9; GTPBP9; PTD004 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |