shRNA Adeno-associated Virus Serotype 2, pH1-(OR1J4-shRNA-Seq6)(CAT#: AAV-SI2484WQ)

This product is a OR1J4-shRNA encoding AAV, which is based on AAV-2 serotype. The OR1J4 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR1J4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert OR1J4-shRNA-Seq6
Related Target/Protein OR1J4
Region CDS
TargetSeq CCCAAAGATGTTATTAAGCAT
NCBI RefSeq XM_294533
Alternative Names OR9-21; HTPCRX01; HSHTPCRX01
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 26219
Uniprot ID Q8NGS1

Related Products

Advertisement