shRNA Adeno-associated Virus Serotype 2, pH1-(OR51F1-shRNA-Seq6)(CAT#: AAV-SI3026WQ)

This product is a OR51F1-shRNA encoding AAV, which is based on AAV-2 serotype. The OR51F1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR51F1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert OR51F1-shRNA-Seq6
Related Target/Protein OR51F1
Region CDS
TargetSeq CGTGATCCTGTTTGTCATCAT
NCBI RefSeq XM_171424
Alternative Names OR11-21; OR51F1P
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 256892
Uniprot ID A6NGY5

Related Products