shRNA Adeno-associated Virus Serotype 2, pH1-(PCOLCE-shRNA-Seq2)(CAT#: AAV-SI0905WQ)

This product is a PCOLCE-shRNA encoding AAV, which is based on AAV-2 serotype. The PCOLCE gene encodes a glycoprotein which binds and drives the enzymatic cleavage of type I procollagen and heightens C-proteinase activity. The expression of PCOLCE-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert PCOLCE-shRNA-Seq2
Related Target/Protein PCOLCE
Region CDS
TargetSeq CCATGAAGAAAGGAGTCAGTT
NCBI RefSeq NM_002593
Alternative Names PCPE; PCPE1; PCPE-1
Titer >1*10^10 GC/mL
Related Diseases Psoriatic arthritis
Target Gene
Gene ID 5118
Uniprot ID Q15113

Related Products

Inquiry Now
Advertisement