shRNA Adeno-associated Virus Serotype 2, pH1-(PIGY-shRNA-Seq2)(CAT#: AAV-SI0569WQ)

This product is a PIGY-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by PIGY gene, which is well-conserved, is encoded by the same bicistronic transcript that encodes phosphatidylinositol glycan anchor biosynthesis, class Y, but the two proteins are unrelated. The expression of PIGY-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert PIGY-shRNA-Seq2
Related Target/Protein PIGY
Region CDS
TargetSeq GATGACACGTCAAAGTAAGAA
NCBI RefSeq NM_032906
Alternative Names PREY
Titer >1*10^10 GC/mL
Related Diseases Hyperphosphatasia and mental retardation syndrome
Target Gene
Gene ID 100996939
Uniprot ID Q96I23

Related Products

Advertisement