shRNA Adeno-associated Virus Serotype 2, pH1-(Pomp-shRNA-Seq2)(CAT#: AAV-SI2576WQ)

This product is a Pomp-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Pomp gene is a molecular chaperone that binds 20S preproteasome components and is essential for 20S proteasome formation. The expression of Pomp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Pomp-shRNA-Seq2
Related Target/Protein Pomp
Region CDS
TargetSeq GCTCAAACCTCTCACTGGATA
NCBI RefSeq NM_025624
Alternative Names UMP1; PRAAS2; HSPC014; C13orf12; PNAS-110
Titer >1*10^10 GC/mL
Related Diseases KLICK syndrome
Target Gene
Gene ID 51371
Uniprot ID Q9Y244

Related Products