shRNA Adeno-associated Virus Serotype 2, pH1-(Pppde1-shRNA-Seq1)(CAT#: AAV-SI2821WQ)
This product is a Pppde1-shRNA encoding AAV, which is based on AAV-2 serotype. The Pppde1 gene has deubiquitinating activity. The expression of Pppde1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Pppde1-shRNA-Seq1 |
Related Target/Protein | Pppde1 |
Region | CDS |
TargetSeq | GGGCGTCACACTAAACTATAA |
NCBI RefSeq | NM_024282 |
Alternative Names | DESI; DESI1; DeSI-2; PNAS-4; PPPDE1; CGI-146; FAM152A; C1orf121; DESI2 |
Titer | >1*10^10 GC/mL |