shRNA Adeno-associated Virus Serotype 2, pH1-(Pppde1-shRNA-Seq4)(CAT#: AAV-SI2824WQ)
This product is a Pppde1-shRNA encoding AAV, which is based on AAV-2 serotype. The Pppde1 gene has deubiquitinating activity. The expression of Pppde1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Pppde1-shRNA-Seq4 |
| Related Target/Protein | Pppde1 |
| Region | CDS |
| TargetSeq | CTTCAGCTTTATCAGAGATTC |
| NCBI RefSeq | NM_024282 |
| Alternative Names | DESI; DESI1; DeSI-2; PNAS-4; PPPDE1; CGI-146; FAM152A; C1orf121; DESI2 |
| Titer | >1*10^10 GC/mL |
