shRNA Adeno-associated Virus Serotype 2, pH1-(PRELID2-shRNA-Seq3)(CAT#: AAV-SI0799WQ)
This product is a PRELID2-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of PRELID2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | PRELID2-shRNA-Seq3 |
Related Target/Protein | PRELID2 |
Region | 3UTR |
TargetSeq | CCAATGCGTTATGATGATTAA |
NCBI RefSeq | NM_138492 |
Titer | >1*10^10 GC/mL |
Related Diseases | Chronic Hepatitis B infection |