shRNA Adeno-associated Virus Serotype 2, pH1-(Ptrh2-shRNA-Seq1)(CAT#: AAV-SI3077WQ)
This product is a Ptrh2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Ptrh2 gene is a mitochondrial protein with two putative domains and possesses peptidyl-tRNA hydrolase activity, to release the peptidyl moiety from tRNA, thereby preventing the accumulation of dissociated peptidyl-tRNA that could reduce the efficiency of translation. The expression of Ptrh2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Ptrh2-shRNA-Seq1 |
Related Target/Protein | Ptrh2 |
Region | CDS |
TargetSeq | CCAGATGAAGACACCCTCATT |
NCBI RefSeq | NM_175004 |
Alternative Names | PTH; BIT1; PTH2; PTH 2; CFAP37; IMNEPD; CGI-147 |
Titer | >1*10^10 GC/mL |
Related Diseases | Pancreatic disease (INMEPD) |