shRNA Adeno-associated Virus Serotype 2, pH1-(Pus7-shRNA-Seq3)(CAT#: AAV-SI2635WQ)
This product is a Pus7-shRNA encoding AAV, which is based on AAV-2 serotype. The Pus7 gene encodes pseudouridylate synthase that catalyzes pseudouridylation of RNAs. The expression of Pus7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Pus7-shRNA-Seq3 |
Related Target/Protein | Pus7 |
Region | CDS |
TargetSeq | CGATTCGAGATTACTCCTTAT |
NCBI RefSeq | NM_178403 |
Alternative Names | IDDABS |
Titer | >1*10^10 GC/mL |