shRNA Adeno-associated Virus Serotype 2, pH1-(RSBN1-shRNA-Seq2)(CAT#: AAV-SI0575WQ)
This product is a RSBN1-shRNA encoding AAV, which is based on AAV-2 serotype. The RSBN1 gene specifically demethylates dimethylated 'Lys-20' of histone H4 (H4K20me2), thereby modulating chromosome architecture. The expression of RSBN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | RSBN1-shRNA-Seq2 |
| Related Target/Protein | RSBN1 |
| Region | CDS |
| TargetSeq | CACTCAGGTCAACAGGACATA |
| NCBI RefSeq | NM_018364 |
| Alternative Names | KDM9; ROSBIN |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |
