shRNA Adeno-associated Virus Serotype 2, pH1-(Sash3-shRNA-Seq1)(CAT#: AAV-SI3096WQ)
This product is a Sash3-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Sash3 gene contains a Src homology-3 (SH3) domain and a sterile alpha motif (SAM), both of which are found in proteins involved in cell signaling. This protein may function as a signaling adapter protein in lymphocytes. The expression of Sash3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Sash3-shRNA-Seq1 |
Related Target/Protein | Sash3 |
Region | 3UTR |
TargetSeq | CCACTATCCTTCTCAACATTT |
NCBI RefSeq | NM_028773 |
Alternative Names | SLY; 753P9; HACS2; CXorf9; SH3D6C |
Titer | >1*10^10 GC/mL |
Related Diseases | Lymphoma |