shRNA Adeno-associated Virus Serotype 2, pH1-(SDK2-shRNA-Seq1)(CAT#: AAV-SI0892WQ)

This product is a SDK2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by SDK2 gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. The expression of SDK2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SDK2-shRNA-Seq1
Related Target/Protein SDK2
Region CDS
TargetSeq GATCCGCTACATTCTGGAGAT
NCBI RefSeq NM_019064
Titer >1*10^10 GC/mL
Related Diseases Retina desease
Target Gene
Gene ID 54549
Uniprot ID Q58EX2

Related Products

Advertisement