shRNA Adeno-associated Virus Serotype 2, pH1-(SESN1-shRNA-Seq1)(CAT#: AAV-SI2609WQ)
This product is a SESN1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by SESN1 gene is a member of the sestrin family. Sestrins are induced by the p53 tumor suppressor protein and play a role in the cellular response to DNA damage and oxidative stress. The expression of SESN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SESN1-shRNA-Seq1 |
Related Target/Protein | SESN1 |
Region | 3UTR |
TargetSeq | GCAAAGAATGGGACTTGGATA |
NCBI RefSeq | NM_014454 |
Alternative Names | PA26; SEST1 |
Titer | >1*10^10 GC/mL |
Related Diseases | DNA damage |