shRNA Adeno-associated Virus Serotype 2, pH1-(SESN3-shRNA-Seq1)(CAT#: AAV-SI2563WQ)
This product is a SESN3-shRNA encoding AAV, which is based on AAV-2 serotype. The SESN3 gene encodes a member of the sestrin family of stress-induced proteins and plays a role in lipid storage in obesity. The expression of SESN3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SESN3-shRNA-Seq1 |
Related Target/Protein | SESN3 |
Region | CDS |
TargetSeq | CGTACTAACTTTCTTGTGGAA |
NCBI RefSeq | NM_144665 |
Alternative Names | SEST3 |
Titer | >1*10^10 GC/mL |
Related Diseases | Obesity |