shRNA Adeno-associated Virus Serotype 2, pH1-(SLC9A11-shRNA-Seq1)(CAT#: AAV-SI0626WQ)
This product is a SLC9A11-shRNA encoding AAV, which is based on AAV-2 serotype. SLC9A11 is a member of the sodium-hydrogen exchanger (NHE) family and involved in pH regulation. The expression of SLC9A11-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SLC9A11-shRNA-Seq1 |
Related Target/Protein | SLC9A11 |
Region | 3UTR |
TargetSeq | GTCAGGTTAAAGACCAAACTA |
NCBI RefSeq | NM_178527 |
Alternative Names | SLC9C2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Endometrial cancer |