shRNA Adeno-associated Virus Serotype 2, pH1-(SPANXN4-shRNA-Seq1)(CAT#: AAV-SI0851WQ)

This product is a SPANXN4-shRNA encoding AAV, which is based on AAV-2 serotype. The SPANXN4 gene represents one of several duplicated family members that are located on the X chromosome. The expression of SPANXN4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SPANXN4-shRNA-Seq1
Related Target/Protein SPANXN4
Region CDS
TargetSeq GAACAGAGTTTGAAAGAGACA
NCBI RefSeq NM_001009613
Alternative Names CT11.9
Titer >1*10^10 GC/mL
Target Gene
Gene ID 441525
Uniprot ID Q5MJ08

Related Products

Advertisement