shRNA Adeno-associated Virus Serotype 2, pH1-(SPATA19-shRNA-Seq1)(CAT#: AAV-SI0665WQ)
This product is a SPATA19-shRNA encoding AAV, which is based on AAV-2 serotype. The SPATA19 may have a role in spermiogenesis. The expression of SPATA19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | SPATA19-shRNA-Seq1 |
| Related Target/Protein | SPATA19 |
| Region | CDS |
| TargetSeq | CGGACATTGACGTTGTGGAAA |
| NCBI RefSeq | NM_174927 |
| Alternative Names | CT132; SPAS1; spergen1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Spermiogenesis |
