shRNA Adeno-associated Virus Serotype 2, pH1-(SPIRE2-shRNA-Seq2)(CAT#: AAV-SI0763WQ)

This product is a SPIRE2-shRNA encoding AAV, which is based on AAV-2 serotype. The SPIRE2 acts as an actin nucleation factor, remains associated with the slow-growing pointed end of the new filament and is involved in intracellular vesicle transport along actin fibers, providing a novel link between actin cytoskeleton dynamics and intracellular transport. The expression of SPIRE2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SPIRE2-shRNA-Seq2
Related Target/Protein SPIRE2
Region 3UTR
TargetSeq CATGATGAAATGTTGTCTCTA
NCBI RefSeq NM_032451
Alternative Names Spir-2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 84501
Uniprot ID Q8WWL2

Related Products