shRNA Adeno-associated Virus Serotype 2, pH1-(Tac4-shRNA-Seq1)(CAT#: AAV-SI3085WQ)
This product is a Tac4-shRNA encoding AAV, which is based on AAV-2 serotype. The products of Tac4 gene preferentially activate tachykinin receptor 1, and are thought to regulate peripheral endocrine and paracrine functions including blood pressure, the immune system, and endocrine gland secretion. The expression of Tac4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Tac4-shRNA-Seq1 |
Related Target/Protein | Tac4 |
Region | CDS |
TargetSeq | CCCAGCATTGAACTTAAGCTT |
NCBI RefSeq | NM_053093 |
Alternative Names | EK; HK1; HK-1; PPT-C |
Titer | >1*10^10 GC/mL |
Related Diseases | Nervous system disease |