shRNA Adeno-associated Virus Serotype 2, pH1-(Tatdn1-shRNA-Seq1)(CAT#: AAV-SI3073WQ)

This product is a Tatdn1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Tatdn1 gene is putative deoxyribonuclease. The expression of Tatdn1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Tatdn1-shRNA-Seq1
Related Target/Protein Tatdn1
Region CDS
TargetSeq CAACCTGACAGATCCTATGTT
NCBI RefSeq NM_175151
Alternative Names CDA11
Titer >1*10^10 GC/mL
Target Gene
Gene ID 83940
Uniprot ID Q6P1N9

Related Products

Inquiry Now
Advertisement