shRNA Adeno-associated Virus Serotype 2, pH1-(Tbc1d22b-shRNA-Seq1)(CAT#: AAV-SI3170WQ)

This product is a Tbc1d22b-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Tbc1d22b gene may act as a GTPase-activating protein for Rab family protein. The expression of Tbc1d22b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Tbc1d22b-shRNA-Seq1
Related Target/Protein Tbc1d22b
Region 3UTR
TargetSeq CGAGTATGTGTGTGTGTGTAT
NCBI RefSeq NM_198647
Alternative Names C6orf197
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55633
Uniprot ID Q9NU19

Related Products

Inquiry Now
Advertisement