shRNA Adeno-associated Virus Serotype 2, pH1-(Tbc1d22b-shRNA-Seq1)(CAT#: AAV-SI3170WQ)
This product is a Tbc1d22b-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Tbc1d22b gene may act as a GTPase-activating protein for Rab family protein. The expression of Tbc1d22b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Tbc1d22b-shRNA-Seq1 |
Related Target/Protein | Tbc1d22b |
Region | 3UTR |
TargetSeq | CGAGTATGTGTGTGTGTGTAT |
NCBI RefSeq | NM_198647 |
Alternative Names | C6orf197 |
Titer | >1*10^10 GC/mL |