shRNA Adeno-associated Virus Serotype 2, pH1-(TEX13B-shRNA-Seq1)(CAT#: AAV-SI0770WQ)
This product is a TEX13B-shRNA encoding AAV, which is based on AAV-2 serotype. TEX13B is spermatogonially-expressed, germ-cell-specific genes. The expression of TEX13B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | TEX13B-shRNA-Seq1 |
| Related Target/Protein | TEX13B |
| Region | CDS |
| TargetSeq | CAGGTCAGTACAAACAGCCAT |
| NCBI RefSeq | NM_031273 |
| Alternative Names | TGC3B; TSGA5 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Testis cancer |
