shRNA Adeno-associated Virus Serotype 2, pH1-(Tmub1-shRNA-Seq1)(CAT#: AAV-SI3132WQ)
This product is a Tmub1-shRNA encoding AAV, which is based on AAV-2 serotype. The Tmub1 gene encodes a protein that may contribute to the regulation of translation during cell-cycle progression and cell proliferation. The expression of Tmub1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Tmub1-shRNA-Seq1 |
Related Target/Protein | Tmub1 |
Region | 3UTR |
TargetSeq | CTAGTTTCAAAGAGCTGCCTA |
NCBI RefSeq | NM_022418 |
Alternative Names | DULP; SB144; C7orf21 |
Titer | >1*10^10 GC/mL |
Related Diseases | Cancer |