shRNA Adeno-associated Virus Serotype 2, pH1-(TREH-shRNA-Seq1)(CAT#: AAV-SI0870WQ)
This product is a TREH-shRNA encoding AAV, which is based on AAV-2 serotype. The TREH gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. The expression of TREH-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | TREH-shRNA-Seq1 |
Related Target/Protein | TREH |
Region | CDS |
TargetSeq | GAATCGCTATTATGTCCCTTA |
NCBI RefSeq | NM_007180 |
Alternative Names | TRE; TREA; TREHD |
Titer | >1*10^10 GC/mL |
Related Diseases | Motoneuron degeneration |