shRNA Adeno-associated Virus Serotype 2, pH1-(TTC18-shRNA-Seq1)(CAT#: AAV-SI0613WQ)

This product is a TTC18-shRNA encoding AAV, which is based on AAV-2 serotype. The TTC18 gene ecoded protein is a novel axoneme-binding protein that localizes at the base of the outer dynein arm and regulates ciliary motility. The expression of TTC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert TTC18-shRNA-Seq1
Related Target/Protein TTC18
Region CDS
TargetSeq CAAGAGTTCCTCTGGTCACTA
NCBI RefSeq NM_145170
Alternative Names CFAP70
Titer >1*10^10 GC/mL
Related Diseases Outer dynein arm (ODA)
Target Gene
Gene ID 118491
Uniprot ID Q5T0N1

Related Products