shRNA Adeno-associated Virus Serotype 2, pH1-(TTC21A-shRNA-Seq2)(CAT#: AAV-SI0790WQ)

This product is a TTC21A-shRNA encoding AAV, which is based on AAV-2 serotype. Bi-allelic Mutations in TTC21A Induce Asthenoteratospermia in Humans and Mice. The expression of TTC21A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert TTC21A-shRNA-Seq2
Related Target/Protein TTC21A
Region CDS
TargetSeq GCAATATTGATGCCTGCCAAA
NCBI RefSeq NM_145755
Alternative Names STI2; SPGF37; IFT139A
Titer >1*10^10 GC/mL
Related Diseases Asthenoteratospermia
Target Gene
Gene ID 199223
Uniprot ID Q8NDW8

Related Products