shRNA Adeno-associated Virus Serotype 2, pH1-(WDR46-shRNA-Seq2)(CAT#: AAV-SI0995WQ)

This product is a WDR46-shRNA encoding AAV, which is based on AAV-2 serotype. The WDR46 gene is required for localization of DDX21 and NCL to the granular compartment of the nucleolus. The expression of WDR46-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert WDR46-shRNA-Seq2
Related Target/Protein WDR46
Region CDS
TargetSeq CTGGAGAGTAATCCATACAGA
NCBI RefSeq NM_005452
Alternative Names UTP7; BING4; FP221; C6orf11
Titer >1*10^10 GC/mL
Related Diseases Respiratory Disease
Target Gene
Gene ID 9277
Uniprot ID O15213

Related Products